НАСЛЕДСТВЕННАЯ ПАТОЛОГИЯ ОРГАНА ЗРЕНИЯ. ХЛЕБНИКОВА ОЛЬГА ВАДИМОВНА.

НАСЛЕДСТВЕННАЯ ПАТОЛОГИЯ ОРГАНА ЗРЕНИЯ

НАСЛЕДСТВЕННАЯ ПАТОЛОГИЯ ОРГАНА ЗРЕНИЯ. ХЛЕБНИКОВА ОЛЬГА ВАДИМОВНА. НАСЛЕДСТВЕННАЯ ПАТОЛОГИЯ ОРГАНА ЗРЕНИЯ. ХЛЕБНИКОВА ОЛЬГА ВАДИМОВНА.
НАСЛЕДСТВЕННАЯ ПАТОЛОГИЯ ОРГАНА ЗРЕНИЯ. ХЛЕБНИКОВА ОЛЬГА ВАДИМОВНА.

МЕДИКО-ГЕНЕТИЧЕСКИЙ НАУЧНЫЙ ЦЕНТР РАМН


http://www.genepid.ru/

Приемные дни:
вторник, среда, четверг с 10 до 15 часов
Запись на прием по телефонам:
+7 (499) 324-87-72
+7 (499) 324-18-65
+7 (499) 324-31-57

Адрес:115478, Москва, ул. Москворечье, д. 1,

метро "Каширская", первый вагон из центра
e-mail:khlebnikova@med-gen.ru

Skype: ophtalmogen1

Дифференциальная диагностика и молекулярно-генетический анализ Х-сцепленной рецессивной хориоретинальной атрофии.

Дифференциальная диагностика и молекулярно-генетический анализ Х-сцепленной рецессивной хориоретинальной атрофии.

 

Хлебникова О.В., Гудзенко С.В., Беклемищева Н.А., Поляков А.В.

 

Значительный клинический полиморфизм и генетическая гетерогенность являются характерными признаками Х-сцепленных наследственных пигментных дегенераций сетчатки (ХСПДС). В данной работе проведён дифференциально-диагностический и молекулярно-генетический анализ ХСПДС в отягощённой татарской семье. В результате исследования показана косегрегация заболевания с локусом Х-сцепленной рецессивной хориоретинальной атрофии (RP2), (Хр11.3) и обнаружена неописанная ранее мутация c.10_12delTTC в экзоне 1 гена RP2. Полученные молекулярно-генетические и дифференциально-диагностические данные позволили подтвердить диагноз «Х-сцепленная рецессивная хориоретинальная атрофия» в семье.

 

Введение

В настоящее время известно около 100 клинико-генетических форм наследственных дистрофических заболеваний сетчатки и хороидеи, которые характеризуются значительным клиническим полиморфизмом и генетической гетерогенностью. В популяциях с разной генетической структурой, данная группа наследственных заболеваний является одной из наиболее частых, приводящих к слепоте с рождения или в среднем возрасте.  Для наследственных периферических дегенераций сетчатки (НПДС), являющихся одними из представителей данной группы наследственных патологий, частота встречаемости составляет 1-2 человека на 10000 населения в Российской Федерации[1].

На сегодняшний день картировано около 30 генетических локусов изолированной НПДС, которая характеризуется тремя типами наследования: аутосомно-рецессивным, аутосомно-доминантным и Х-сцепленным [2]. Аутосомно-рецессивный и аутосомно-доминантный типы наследования являются самыми частыми среди всех НПДС, их частоты сотавляют 84% и 10%, соответственно [3].  На долю Х-сцепленного типа наследственных пигментных дегенераций сетчатки (ХСПДС) приходится около 6% всех случаев пигментной дегенерации сетчатки, однако данный тип характеризуется наибольшей тяжестью клинического течения [3].

На сегодняшний день известно о пяти локусах ХСПДС: RP2 (MIM 312600) (Xp11.4-p11.23) [4], RP3 (MIM 312610) (Xp21.1) [5], RP6 (MIM 312612) (Xp21.3-p21.2)[6], RP23 (MIM 300424) (Xp22)[7] и RP24 (MIM 300155) (Xq26-q27)[8]. Однако гены идентифицированы только для двух локусов: RP2 (ген RP2, MIM 312600) и RP3 (ген RPGR, MIM 312610). В соответствие с названием указанных генов, выделяют формы ХСПДС - RP2  и RP3. Мутации в соответствующих генах являются причиной возникновения 70% и 10% случаев ХСПДС, соответственно [9].

Х-сцепленная рецессивная хориоретинальная атрофия (периферическая дегенерация сетчатки 2 типа, RP2, или пигментная ретинопатия, MIM 312600)– Х-сцепленная форма пигментной дегенерации сетчатки, характеризующаяся прогрессирующей хориоретинальной атрофией в сочетании с периферической пигментной дегенерацией, приводящей к сужению полей зрения, гемеролапии, снижению остроты центрального зрения и нарушению цветоощущения. Однако, перечисленные клинические признаки RP2 не являются специфичными для данной патологии и характерны для некоторых других форм ХСПДС. Таким образом, высокая клиническая гетерогенность ХСПДС, ведущим признаком которых является хориоретинальная дегенерация глазного дна, не позволяют на клиническом уровне однозначно определить форму заболевания в конкретной семье. Среди форм с Х-сцепленным рецессивным типом наследования сходной клинической картиной характеризуются хориодермия (OMIM 303100), периферическая дегенерация сетчатки 3 типа (RP3, OMIM 300389) и периферическая дегенерация 6 типа (RP6, OMIM 312612). Значительным сходством обладают формы RP2 и RP3, практически не отличающиеся по своей клинике (Рис.1) [9].

Курсивом обозначены микросателлитные полиморфные маркёры, расположенные вблизи локуса RP2, с которыми проводился анализ сцепления. В скобках указан хромосомный регион локусов, координаты маркёров и гена RP2

 

Ген RP2, ответственный за развитие периферической дегенерации сетчатки 2 типа,  идентифицированный в 1998 году,  расположен в регионе Xp11.4-p11.21 и состоит из 5 экзонов [10]. Одноимённый белок, кодируемый геном  RP2 (референсный сиквенс мРНК-NM_006915)  состоит из 350 аминокислотных остатков и характеризуется повсеместной экспрессией. Функция белка RP2 остаётся до конца неизученой. Известно, что белок RP2 встроен в плазматическую мембрану палочковых и колбочковых фоторецепторов сетчатки, обладает гомологией с тубулин-специфичным кофактором шаперонов С , и подобно ему стимулирует ГТФ-азную активность тубулина, участвуя таким образом в процессах  проведения внутриклеточного сигнала и везикулярном транспорте[11,12,13,14].

На сегодняшний день описано около 60 различных мутаций в гене RP2, большинство из которых являются аминокислотными заменами [15].

Для подтверждения клинического диагноза «Х-сцепленная рецессивная хориоретинальная атрофия» и дифференциального диагноза данной патологии сетчатки с другими, клинически схожими формами ХСПДС, целью данной работы был дифференциально-диагностический поиск, а также разработка прямой и косвенной ДНК-диагностики Х-сцепленной рецессивной хориоретинальной атрофии, в том числе диагностики гетерозиготного носительства в отягощённой семье.

 

Материалы и методы

Семья

Исследование проведено на материале татарской семьи с предположительным диагнозом «Х-сцепленная рецессивная хориоретинальная атрофия». Семья состоит из 28 человек, в числе которых наблюдается 6 больных ( 5 мужчин и одна женщина) в 4 поколениях (Рис. 2). Для ДНК-анализа были доступны 26 человек из этой семьи, в числе которых 6 человек (5 мужчин и 1 женщина) больны (Рис.2).

На рисунке представлены результаты анализа гаплотипов по маркёрам  NDPCA, DXS1003 и DXS1055, тесно сцепленными с геном RP2

 

Офтальмологическое обследование как больных, так и здоровых членов семьи (в возрасте от 10 до 45 лет) проводилось врачом офтальмологом-генетиком на базе ФГУ Московского НИИ глазных болезней им. Гельмгольца. Всем членам семьи проведен комплекс офтальмологических (визометрия, биомикроскопия, тонометрия, ретиноскопия в белом, красном и зеленом цветах, определение цветного зрения, компьютерная периметрия, флуоресцентная ангиография) и электрофизиологических методов исследования.

Все пациенты от нормально протекавшей беременности, срочных нормальных родов, росли и развивались соответственно возрастным нормам. Нарушений других органов и систем не обнаружено. У четырёх больных мужчин от 16 до 45 лет и одной больной женщины обнаружена сходная клиническая картина патологических изменений органа зрения. Заболевание характеризовалось двусторонностью поражения глаз с ассиметричностью развития патологического процесса на парных глазах.

Пациенты IV.2 (14 лет) и IV.6 (16 лет).  Снижение  центральной остроты зрения  появилось в возрасте 5-6 лет, нарушение темновой адаптации – через два года. Острота зрения у пациента IV.6 на правый глаз 0,5, на левый глаз 0,3 с коррекцией  -3,0 дптр; у пациента IV.2 острота зрения с коррекцией -0,5 дптр. - 1,0 на оба глаза. Результаты исследования полей зрения показали резкое снижение фоточувствительности   рецепторов в парамакулярной области до 15дцб.; от 15гр. реакции фоторецепторов на заданный стимул не было; однако изменения полей зрения у пациента IV.2 менее выражены за счет  большего количества  относительных  скотом 1 и 2 порядка.  Установлена  грубая патология цветного зрения на красный, зеленый и синий цвета. Электрофизиологические исследования показали снижение амплитуды зрительно вызванных потенциалов в 3-4 раза с сохранением латентности. На общей электроретинограмме  установлено снижение в среднем в 3 раза амплитуды волны «а» и « в» с  сохранением латентности. Ритмическая ЭРГ была снижена в 5 раз по сравнению с возрастной нормой. Показатели локальной ЭРГ у пациента IV.2: амплитуда волн «а»  и « в» на красный, зеленый и синий цвета снижена в 3-4 раза, латентность в пределах нормы, показатели на парных глазах ассиметричны. У пациента IV.6 флуоресцентная ангиография  выявила системное нарушение артериального кровообращения и симптомы пигментной абиотрофии сетчатки обоих глаз (Рис. 3); у пациента IV.2 обнаружено сужение артерий сетчатки и уменьшение количества артериол 3 и 4 порядка.

На рисунке представлены результаты флуоресцентной ангиографии сосудов сетчатки глаза, проведенной у больного мальчика IV.6 (А), больной женщины (III.5) и здорового мальчика (IV.3) из исследованной семьи.

 

 При биомикроскопии обнаружено легкое помутнение под задней капсулой хрусталиков обоих глаз. При ретиноскопии обнаружены участки дистрофии хориокапиллярного слоя на крайней и средней периферии; выявлено наличие гиперпигментации сетчатки и перераспределение пигментного эпителия по всему глазному дну (Рис. 4).

На рисунке представлены результаты ретиноскопии глаза, проведенной у больного мальчика IV.6 (А), больной женщины (III.5) и здорового мальчика (IV.3) из исследованной семьи.

 

Пациентка III.5 (38 лет).  Заболевание манифестировало в 20 лет. Миопия на правый глаз в 7,0 дптр., на левый глаз - 9,0 дпрт., острота зрения с коррекцией была соответственно 0,7 и 0,2. Установлена грубая патология цветного зрения на красный, зеленый и синий цвета. Электрофизиологические исследования показали снижение амплитуды зрительно вызванных потенциалов в 3-4 раза с сохранением латентности. На общей электроретинограмме  установлено снижение в среднем в 3 раза амплитуды волны «а» и « в» с  сохранением латентности. Ритмическая ЭРГ снижена в 5 раз по сравнению с возрастной нормой. Показатели локальной ЭРГ: амплитуда волн «а»  и « в» на красный, зеленый и синий цвета снижена в 3-4 раза, латентность в пределах нормы, показатели на парных глазах ассиметричны. Флуоресцентная ангиография  выявила системное нарушение артериального кровообращения и симптомы пигментной абиотрофии сетчатки обоих глаз (Рис. 3). Ретиноскопия характеризовалась значительной степенью тяжести:  деколорация дисков зрительных нервов с височной стороны (больше на левом глазу),  наличие миопического конуса, сужение сосудов сетчатки, выраженная атрофия хориокапиллярного слоя  по всему глазному дну (больше на левом глазу), значительное количество «костных телец» на крайней и средней периферии глазного дна; макулярная область не дифференцировалась (Рис. 4).

Пациентка III.4 (35 лет).  Мать больного мальчика IV.2. Каких-либо жалоб на зрение не предъявляла. Патология сред глаза и глазного дна не выявлена; острота зрения и цветоощущение в норме. На ЭРГ установлено снижение амплитуды зрительно-вызванных потенциалов в 2,5 раза; показатели ЭРГ не изменены.

Пациент IV.3 (14 лет). Клинически здоров. Результаты ретиноскопии и флуоресцентной ангиографии, находящиеся в пределах нормы, представлены на рисунках 3 и 4.

 

Методы исследования

Комплекс электрофизиологических методов  исследования проведен на компьютерной установке "Нейро ЭРГ" фирмы Нейрософт (Россия). Зрительновызванные потенциалы регистрировались на вспышку и на шахматный паттерн. Размеры клеток шахматного поля измерялись в угловых минутах. Расстояние до экрана -1 метр. Электроретинограмма включала в себя следующие пробы: локальная ЭРГ (12 гр.) на красный, зеленый, синий цвета; глобальная ЭРГ (30 гр.) на красный, зеленый и синий цвета; ритмическая ЭРГ (30гц); общая ЭРГ (120гр.,скотопическая) на белый и синий цвета. Исследования проводились с помощью стимуляторов penlight уравненных по яркости (с концентратором 12 гр. - яркость 100м СЯ).

Компьютерная периметрия производилась на аппарате Twinfield, Oculus (Германия).

Флюорисцентная ангиография осуществлена на ретинальной камере Topcon TRC-50 Ex.

Образцы крови были взяты с информированного согласия членов семьи. Выделение геномной ДНК из лейкоцитов периферической крови выполнялось с помощью набора реактивов для выделения DLAtomäDNA Prep100 по протоколу производителя. Исследование проводилось с помощью полиморфных микросателлитных маркёров: NDPCA, DXS1003 и DXS1055. Праймеры для амплификации микросателлитных маркёров, фрагментов гена RP2, а также длины амплифицируемых фрагментов указаны в Таблицах 1 и 2. Амплификация фрагментов ДНК проводилась методом полимеразной цепной реакции на программируемом термоциклере МС2 фирмы «ДНК-технология» (Россия) в 25ml объёме реакционной смеси следующего состава: 0,1-1,0 mg геномной ДНК; 0, 025 mМ каждого олигонуклеотидного праймера; 200 mМ каждого нуклеотидтрифосфата; 1 единица ДНК-полимеразы Biotaq («БиоМастер»); буфер для ПЦР (67 mM Tris-HCl, 16,6 mM (NH4)2SO4, 0,01% Twin-20, pH 8,8); 20-30 ml минерального масла; условия реакции (концентрация  MgCl2 и температура отжига праймеров) указаны в Таблицах 1 и 2.

Таблица 1.

Праймеры, длины фрагментов и условия амплификации микросателлитных  маркёров NDPCA, DXS1055 и DXS1003.

Маркёр

Праймеры

Длина фрагмента, п.н.

Т отжига, °С

Концентрация MgCl2, mM

NDPCA

F: ATCTTTCAAACTTCTGCTTTACCAC

R: AAAGACTATGAAGCAATTATTGAACC

150-160

58

4

DXS1055

F: cttactctatgggatacactgttc

R: ccccatcattaaacaatgcacaac

97-109

62

6

DXS1003

F: tagaagccgttattggtggactc

R: cattcctcactggcaagttttaac

160-186

62

4

 

 

 

 

 

 

 

 

Таблица 2.

Праймеры, условия амплификации и длины фрагментов гена RP2.

 

Фрагмент

Праймеры

Длина фрагмента, п.н.

Т отжига, °С

Концентрация MgCl2, mM

RP2 ex1

1F: ctcaacaggcgctgagcgttc

               1R: cggctcagggaggctgagac

367

67

2

RP2 ex2

2F: cagccaatagtcctttagttgatac

2R: atggaagtactccagagtggtac

810

60

6

RP2 ex3

3F: aatcattgttttagtctcagaagttc

3R: taaagaaaatatccacaaaagtatacc

219

60

6

 

RP2 ex4

 

 

4F: caaagaagatgctggagattcttc

4R: aatgaaaagttagattgaaatacagtc

228

60

6

 

RP2 ex5

 

 

5F: ttggaactttgttctgtggagaac

5R: CATTAGTAAAAACCATTGCTAATACAC

274

62

6

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Для идентификации мутации c.10_12delTTC проводился анализ длины рестрикционных фрагментов (ПДРФ) с использованием эндонуклеазы AluI («Сибэнзим», Россия) согласно протоколу фирмы-производителя. Результаты амплификации, анализа полиморфизма длины амплификационных и рестрикционных фрагментов оценивались с помощью электрофореза в 7-8% полиакриламидном геле (соотношение акриламида к бисакриламиду 29:1-1,3) с последующим окрашиванием геля раствором бромистого этидия и регистрацией в УФ-излучении (длина волны 312 нм). Определение нуклеотидной последовательности амплифицированных фрагментов ДНК проводили на генетическом анализаторе GA3130 (Applied Biosystems) с использованием набора BigDye Terminator v1.1(Applied Biosystems) по протоколу фирмы производителя.

 

Результаты и обсуждение

Нами описана семья с предположительным диагнозом «Х-сцепленная рецессивная хориоретинальная атрофия», основными признаками которой являются снижение центральной остроты зрения, концентрическое сужение полей зрения, гемеролопия, атрофия хороидеи, периферическая пигментная дегенерация сетчатки, нарушение цветного зрения, миопия  слабой или средней степени, возникшая в возрасте 5-6  лет. Особенностью данной семьи являлось то, что у одной из гетерозиготных носительниц повреждённого гена (III.5) наблюдалась  развернутая клиническая картина заболевания, что нехарактерно для Х-сцепленных рецессивных заболеваний, однако манифестация патологического процесса  у данной пациентки произошла на 15 лет позже, чем у больных мальчиков в семье. При этом у остальных женщин-носительниц (I.1, II.2, II.3, III.4, III.7, III.9 и IV.1) клинические признаки заболевания были выражены слабо или полностью отсутствовали; изменения электрофизиологических показателей отмечались у пациенток III.4, III.7. Такая вариабельная экспрессивность признака в семье осложнила определение типа наследования заболевания при диагностике. Данный факт, а также значительная клиническая гетерогенностью НПДС послужили поводом для проведения дифференциального диагноза между несколькими клинико-генетическими формами  наследственных дегенераций сетчатки, ведущим клиническим признаком которых является хориоретинальная дегенерация глазного дна. Среди форм с Х-сцепленным рецессивным типом наследования сходной клинической картиной характеризуются: хориодермия (OMIM 303100), периферическая дегенерация сетчатки 3 типа (RP3, OMIM 300389), периферическая дегенерация сетчатки 6 типа (RP6, OMIM 312612) (Рис. 1). 

Наиболее схожим клиническим фенотипом при проведении диагностики на развернутой стадии болезни обладает хориодермия. Хориодермия (OMIM 303100) - редкое Х-сцепленное наследственное заболевание сетчатки, характеризующееся прогрессирующей дегенерацией хориокаппилярного слоя сосудов сетчатки, приводящей к дегенеративным изменениям фоторецепторов. Картина иногда практически полного отсутствия хориокаппилярного слоя может имитировать врожденную аномалию сетчатки, например колобому. У мужчин хориодермия приводит к слепоте, у женщин-носительниц могут обнаруживаться изменения глазного дна, не приводящие к слепоте или каким-либо значимым нарушениям зрительной функции. Дифференциальная диагностика основывается на особенностях патогенеза заболевания: при хориодермии манифестация заболевания происходит в хориокаппилярном слое, и только через какое-то время происходит вовлечение в патологический процесс фоторецепторов сетчатки. Таким образом, изменения глазного дна, отражающие патологию фоторецепторов и пигментного эпителия («костные тельца», отложения пигмента, дефекты пигментного эпителия) не являются обязательным признаком хориодермии, или появляются в процессе прогрессирования заболевания. Кроме того,  у женщин-носительниц в случае хориодермии при наличии картины патологии глазного дна, как правило, отсутствуют или выражены незначительно симптомы нарушения зрительной функции (сумеречная слепота, сужение полей зрения) и электроретинографические признаки дисфункции фоторецепторов. В отличие от них, у носительниц мутаций, вызывающих RP2, наиболее часто выявляются изменения палочкового компонента ЭРГ и нарушения темновой адаптации при отсутствии изменений глазного дна [16,17,18].

Периферическая дегенерация сетчатки 3 типа (RP3, OMIM 300389) – одна из форм ХСПДС, природа возникновения которой обусловлена мутациями в гене регулятора ГТФазы RPGR (OMIM 312610). Клинической особенностью RP3 является выявление специфической картины глазного дна и электроретинографических признаков дисфункции фоторецепторов различной степени выраженности у женщин-носительниц патологической мутации гена при отсутствии нарушений зрительной функции. Характерным является наличие сверкающего, «бриллиантового», золотистого рефлекса, локализованного преимущественно в парамакулярной области сетчатки. Клиническая картина заболевания у мужчин сходна с картиной периферической дегенерации сетчатки 2 типа, однако, атрофия хориокаппиляров менее выражена и выявляется на более поздних стадиях развития болезни [18,19,20].

Еще одна форма ХСПДС, с которой необходимо проводить дифференциальную диагностику RP2 - периферическая дегенерация сетчатки 6 типа (RP6, OMIM 312612), локализованная в области Xp21.3-p21.2. Ген, ответственный за данную патологию до настоящего времени не идентифицирован. В клинической картине больных мужчин характерными признаками являются хориоретинальная дегенерация и пигментные изменения периферии сетчатки. Основным диагностическим критерием этой формы заболевания является обнаружение специфического «металлического» блеска или «металлического» рефлекса глазного дна у женщин-носительниц патологической мутации. Данный симптом не является обязательным для всех женщин-носительниц; в некотором проценте случаев у них может обнаруживаться и другая симптоматика, характерная для периферических дегенераций сетчатки, что затрудняет проведение дифференциальной диагностики. Однако, выявлены закономерности между изменениями на глазном дне у женщин-носительниц на начальной стадии заболевания и прогнозом зрительной функции, позволяющие делать более благоприятный прогноз для женщин, у которых обнаруживается только симптом «металлического» рефлекса с глазного дна без пигментных изменений сетчатки. Необходимо отметить, что в случае наличия «металлического» рефлекса с глазного дна у женщины-носительницы возникает необходимость дифференциации двух форм Х-сцепленной периферической дегенерации сетчатки-RP3 и RP6.

Для подтверждения связи предполагаемой формы Х-сцепленной пигментной дегенерации сетчатки с локусом RP2 и исключения других форм ХСПДС со схожими клиническими проявлениями, на первом этапе молекулярно-генетического исследования мы провели анализ сцепления заболевания в семье с высокополиморфными микросателлитными маркёрами NDPCA, DXS1003 и DXS1055, расположенными в непосредственной близости от гена RP2 на хромосоме Xp11.3 (Рис. 1).

В результате гаплотипирования семьи по маркёрам NDPCA, DXS1003 и DXS1055 было обнаружено, что все больные члены семьи имели одинаковый гаплотип по указанным маркёрам (Рис.2). Данные по маркёру NDPCA оказались неинформативными (Рис. 2). Таким образом, полученные молекулярно-генетические данные свидетельствуют в пользу сцепления заболевания в семье с локусом RP2 на хромосоме Xp11.3.

Прямое автоматическое секвенирование всех экзонов и экзон-интронных соединений гена RP2 (NM_006915) у больного мужчины II.1 обнаружило неописанную ранее мутацию  c.10_12delTTC  в гемизиготном состоянии в экзоне 1 (Рис.5). 

A - фрагмент электрофореграммы нуклеотидной последовательности экзона 1 гена RP2 с мутацией c.10_12delTTC у больного мужчины II.1;

B- фрагмент электрофореграммы нуклеотидной последовательности экзона 1 гена RP2 у здорового мужчины

 

 Данная делеция приводит к укорочению белка RP2 на одну аминокислоту фенилаланин в  кодоне 4 (p. Phe4del) и не приводит к сдвигу рамки считывания. Мутация может быть зарегистрирована в ходе анализа полиморфизма длины амплификационных фрагментов, которые с целью оптимизации длины фрагментов для разделения, предварительно обрабатывались рестриктазой AluI, имеющей сайты узнавания в экзоне 1 гена RP2. Данная трёхбуквенная делеция приводит к соответствующему укорочению амплифицируемого фрагмента экзона 1 гена RP2 с 367 до 364 п.н., что в ходе последующего проведения анализа полиморфизма длины рестрикционных фрагментов в полиакриламидном геле (ПДРФ), после предварительного инкубирования с рестриктазой AluI, приводит к появлению фрагментов длиной 133, 100, 62, 52, 8 и 12 п.н. в случае отсутствия и фрагментов длиной 133, 97, 62, 52, 8 и 12 п.н. в случае наличия делеции c.10_12del TTC.

В результате проведения ПДРФ анализа в семье делеция c.10_12delTTC была обнаружена у всех больных мальчиков (II.1, II.4, III.2, IV.2 и IV.6) в гемизиготном состоянии, а у женщин-носительниц (I.1, II.2, II.3, III.4, III.5, III.7, III.9 и IV.1) - в гетерозиготном (Рис. 6). У здоровых мужчин (III.11, IV.3 и IV.8) и женщин III.1, IV.4, IV.5, IV.7 данная мутация не обнаружена (Рис. 6).

На рисунке представлены результаты ПДРФ анализа на наличие мутации c.10_12delTTC в экзоне 1 гена RP2 у пациентов IV.2, I.1, IV.3, IV.4, IV.5, IV.6, IV.7 и IV.8, с помощью рестриктазы AluI:

у больных мальчиков IV.2 и IV.6 выявлен фрагмент длиной 97 п.н., что соответствует наличию мутации c.10_12delTTC в гемизиготном состоянии;

у здоровых мальчиков IV.3 и IV.8 выявлен фрагмент длиной 100 п.н., что соответствует норме;

у здоровых девочек IV.4, IV.5 и IV.7 выявлен фрагмент длиной 100 п.н., что также соответствует норме;

у женщины-носительницы патологического гена I.1 выявлены фрагменты длиной 97 и 100 п.н., что соответствует наличию мутацииc.10_12delTTC в гетерозиготном состоянии.

 

 

Полученные молекулярно-генетические данные подтверждают клинический  диагноз «Х-сцепленная рецессивная хориоретинальная атрофия сетчатки» у больных мужчин II.1, II.4, III.2, IV.2, IV.6 и больной женщины III.5. Женщины I.1, II.2, II.3, III.4, III.7, III.9 и IV.1 являются гетерозиготными носительницами патологического гена.

Наличие клинической картины заболевания у женщины- гетерозиготной носительницы мутации (III.5) вероятно является следствием несбалансированной лайонизации.

В ходе проведенного комплексного клинического дифференциально-диагностического и молекулярно-генетического исследования была разработана методика ДНК-диагностики Х-сцепленной рецессивной хориоретинальной атрофии сетчатки, с помощью которой обнаружена неописанная ранее мутация c.10_12del TTC в гене RP2, что позволило подтвердить клинический диагноз и провести прямую и косвенную ДНК-диагностику заболевания в отягощённой семье. Определение гетерозиготного носительства патологического гена в семье позволяет также планировать и проводить мероприятия по пренатальной диагностике Х-сцепленной рецессивной хориоретинальной атрофии сетчатки.

Таким образом, выраженная клиническая гетерогенность и недостаточная изученность клинико-генетических корреляций существенно осложняют  проведение диагностики наследственных хориоретинальных атрофий сетчатки. Для проведения более точного дифференциального диагноза показано обязательное комплексное клинико-лабораторное обследование всех членов семьи пробанда. Кроме того, при диагностике хориоретинальных атрофий необходимо учитывать возможность вариабельной экспрессивности симптомов как у гетерозиготных носительниц мутации. Использованный в данной работе комплексный подход к диагностике наследственных хориоретинальных атрофий сетчатки позволяет значительно повысить эффективность медико-генетического консультирования отягощённых семей.

 

 

 

 

Список литературы

  1. Хлебникова О.В. Наследственная патология органа зрения в популяциях с разной генетической структурой // Диссертация. – 1998. – стр. 326.
  2.  Debra K. B., Beverly M. Y., Filippova E., Hiriyanna S. A comprehensive mutation analysis of RP2 and RPGR in a North American cohort of families with X-linked retinitis pigmentosa // Am. J. Hum. Genet. – 2002. – Vol. 70(6). – P. 1545–1554.
  3. Boughman J.A., Conneally P.M., Nance W.E. Population genetic studies of retinitis pigmentosa // Am. J. Hum. Genet. – 1980. – Vol. 32. – P. 223-235.
  4. Bhattacharya S.S., Wright A.F., Clayton J.F., Price W.H., Phillips C.I., McKeown C.M., Jay M., Bird A.C., Pearson P.L., Southern E.M., Evans H.J. Close genetic linkage between X-linked retinitis pigmentosa and a restriction fragment length polymorphism identified by recombinant DNA probe L1.28 // Nature. – 1984. – Vol. 309. – P. 253-255.
  5. Musarella M.A., Burghes A., Anson-Cartwright L., Mahtani M.M., Argonza R., Tsui L.C., Worton R. Localization of the gene for X-linked recessive type of retinitis pigmentosa (XLRP) to Xp21 by linkage analysis // Am. J. Hum. Genet. -  1988. – Vol. 43. – P. 484-494.
  6. Ott J., Bhattacharya S., Chen J.D., Denton M.J., Donald J., Dubay C., Farrar G.J., Fishman G.A., Frey D., Gal A., Humphries P., Jay B., Jay M., Litt M., Machler M., Musarella M., Neugebauer M., Nussbaum R.L., Terwilliger J.D., Weleber R.G., Wirth B., Wong F., Worton R.G., Wright A.F. Localizing multiple X chromosome-linked retinitis pigmentosa loci using multilocus homogeneity tests // Proc. Natl. Acad. Sci. USA. – 1990. – Vol. 87. – P. 701-704.
  7. Hardcastle A.J., Thiselton D.L., Zito I., Ebenezer N., Mah T.S., Gorin M.B., Bhattacharya S.S. Evidence for a new locus for X-linked retinitis pigmentosa (RP23) // Invest. Ophthalmol. Vis. Sci. – 2000. – Vol. 41. – P. 2080-2086.
  8. Gieser L., Fujita R., Goring H.H., Ott J., Hoffman D.R., Cideciyan A.V., Birch D.G., Jacobson S.G., Swaroop A. A novel locus (RP24) for X-linked retinitis pigmentosa maps to Xq26-27 // Am. J. Hum. Genet. – 1998. – Vol. 63. – P. 1439-1447.
  9. Miano M.G., Testa F., Filippini F., Trujillo M., Conte I., Lanzara C., Millan J.M., De Bernardo C., Grammatico B., Mangino M., Torrente I., Carrozzo R., Simonelli F., Rinaldi E., Ventruto V., D'Urso M., Ayuso C., Ciccodicola A. et al. Identification of novel RP2 mutations in a subset of X-linked retinitis pigmentosa families and prediction of new domains // Hum. Mutat. – 2001. – Vol. 18(2). – P. 109-119.
  10.  Schwahn U., Lenzner S., Dong J., Feil S., Hinzmann B., van Duijnhoven G., Kirschner R., Hemberger M., Bergen A. A. B., Rosenberg T., Pinckers A. J. L. G., Fundele R., Rosenthal A., Cremers F. P. M., Ropers H.H., Berger W. Positional cloning of the gene for X-linked retinitis pigmentosa 2 // Nature Genet. – 1998. – Vol. 19. – P. 327-332.
  11.  Grayson C., Bartolini F., Chapple J. P., Willison K. R., Bhamidipati A., Lewis S. A., Luthert P. J., Hardcastle, A. J., Cowan N. J., Cheetham M. E. Localization in the human retina of the X-linked retinitis pigmentosa protein RP2, its homologue cofactor C and the RP2 interacting protein Arl3 // Hum. Molec. Genet. -  2002. – Vol. 11. – P. 3065-3074.
  12. Chapple J.P., Hardcastle A.J., Grayson C., Spackman L.A., Willison K.R., Cheetham M.E. Mutations in the N-terminus of the X-linked retinitis pigmentosa protein RP2 interfered with the normal targeting of the protein to the plasma membrane // Hum. Mol. Genet. – 2000. – Vol. 9. – P. 1919–1926.
  13. Chapple J.P., Hardcastle A.J., Grayson C., Willson K.R., Cheetham M.E. Delineation of the plasma membrane targeting domain of the x-linked retinitis pigmentosa protein RP2 // Invest. Ophthalmol. Vis. Sci. – 2002. – Vol. 43. – P. 2015–2020.
  14. Chapple J.P., Grayson C., Hardcastle A.J., et al. Organization on the plasma membrane of the retinitis pigmentosa protein RP2: investigation of association with detergent-resistant membranes and polarized sorting // Biochem. J. – 2003. – Vol. 372. – P. 427–433.
  15. http://www.hgmd.cf.ac.uk/ac/index.php
  16. Pameyer J. K., Waardenburg P. J., Henkes H. E. Choroideremia // Brit. J. Ophthal. – 1960.- Vol.  44. – P.  724-738.
  17. Sorsby A., Savory M. Choroidal sclerosis: a possible intermediate sex-linked form // Brit. J. Ophthal. – 1956. – Vol. 40. – P. 90-95.
  18. Souied E., Segues B., Ghazi I., Rozet J.-M., Chatelin S., Gerber S., Perrault I., Michel-Awad A., Briard M.-L., Plessis G., Dufier J.-L., Munnich A., Kaplan J. Severe manifestations in carrier females in X linked retinitis pigmentosa // J. Med. Genet. – 1997. – Vol. 34. – P. 793-797.
  19. Sandberg M. A., Rosner B., Weigel-DiFranco C., Dryja T. P., Berson E. L. Disease course of patients with X-linked retinitis pigmentosa due to RPGR gene mutations // Invest. Ophthal. Vis. Sci. – 2007. – Vol. 48. – P. 1298-1304.
  20. Grover S., Fishman G. A., Anderson R. J., Lindeman M. A longitudinal study of visual function in carriers of X-linked recessive retinitis pigmentosa // Ophthalmology. – 2000. – Vol. 107. – P. 386-396.